Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone SYA303
Clone ID SYA303
Vector pGT0Lxf
Project baygenomics

Sequence tag SYA303
Sequence
CAGGCTCTCGGTGGCGGCGGAGGCGGCGGAGGCCAGGGAGGAAGATGTCGTAATGAGC
Sequence Type mRNA
Unitrap ID UNI5311

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 96838936..96838993 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018678 (Sp2) NM_030220 Sp2 transcription factor Gene [Source:MGI (curated);Acc:Sp2-001]

 
Come back to gene ENSMUSG00000018678


For any suggestions or comments, please send an email to unitrap@crg.es