Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone SYA299
Clone ID SYA299
Vector pGT0Lxf
Project baygenomics

Sequence tag SYA299
Sequence
CGCCGCTGCCGCCGTCGCCACCGCCGCCACCGCCGCCACCGCCACGGTCCCGGTCTCTGCCGGAGAGCTCTCAGCATCTC
TCCCGGACACCCAGCCCCTCCGTGCAGCCGGACGCCGCGCTCTAGGGTTTGCGGGAGCCTAGCCAAAGCCTAGCCAAAGT
TGCTGCCGACTGCGGGGCGGGCGGCGGGACGGCCCCGGTCCCCTCCCCTCCGTCATCCCTGCTTGCGGACTCCCGGGTCA
TGGGGAACACTGCGATCGCCAAGAAAGGCAGCGAAGTGGAGAGCGGTC
Sequence Type mRNA
Unitrap ID UNI139

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 146475600..146475886 283
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005034 (Prkacb) NM_011100 protein kinase, cAMP dependent, catalytic, beta Gene [Source:MGI (curated);Acc:Prkacb-001]

 
Come back to gene ENSMUSG00000005034


For any suggestions or comments, please send an email to unitrap@crg.es