Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST260918
Clone ID OST260918
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST260918
Sequence
GACTGAGGGAGAGTATTGTCTGTCCTAGAGTTTTGCTAGCACCTTTTTAAAGTGATCTTAGCTTGCTTCTTATGTGGGAA
CTGCCTAGACTTCCTACTTTTCACTGCAGAAGCTTCTGATCTACAGTTGCCAGAGACGGAAGCACACACCTTTAGGAGAT
CGTTTACATTAAGCTGGAGAGCCCTTCTCTGCTTGCTCTAAAATGCTGAGGTACTGGGGAGAGATACCAATACCGNCAGG
ACAGACCAACAGAAGTTCCTTTGATCTGCTCCCACGGGAGTTCCGTCTGGTGGAAGTCCATGACCCGCCCCTGCACCAGC
CCTCAGCCAACAAGCCGAAGCCCCCCACGAGGCTGGACTCCCTCAGAGCCCTGACGACTCAGACAGNAGCTATGGTTCCC
ACTCCACTGACAGCCTCATGGGGTCCTCCCCTGTGTTCAATCAGCGCTGCAGGAAGAGGATGAGGAAGATTTAACTGCAG
AGCGCCAGCAGGAAGCCCATGAGTA
Sequence Type mRNA
Unitrap ID UNI23403

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 31818006..31825636 356
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053134 (Supt7l) NM_028150 suppressor of Ty 7 (S. cerevisiae)-like Gene [Source:MGI (curated);Acc:Supt7l-002]

 
Come back to gene ENSMUSG00000053134


For any suggestions or comments, please send an email to unitrap@crg.es