Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST260761
Clone ID OST260761
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST260761
Sequence
GACTGAGGTTGTTTCTGAGCACCTTCCTCTAGCCGTGTCAGCTGGCGCGGTTTTGCTTTTACCCTTCTCAATCATCAGCA
ATGAGATCCTGCTTGCTTTTCCTCACAACTACTATATTCAGTGGCTGAATGGCTCCCTCATCCACGGTTTGTGGAATCTT
GCTTCTTTATTTTCCAATCTTTGTTTATTTGTGTTGATGCCCTTTGCCTTTTTCTTTCTGGAATCAGAAGGTTTTGCAGG
CCTGAAAAAGGGAATCCGAGCCCGCATTTTGGAAACTCTGGTTATGCTGCTGCTTCTTGCGTTGCTGATTCTTGGGATGG
TGTGGGTGGCTTCCGCCCTGATTGACAGTGATGCTGCCAGTATGGAGTCTTTATATGATCTCTGGGAATTCTACTTGCCC
TATTTGTATTCTTGCATTTCGCTGATGGGATGCTTGCTGCTTCTCTTGTGTACTCCAGTTGGCCTGTCCCGTATGTTCAC
AGTCATGGGTCAGTTGCTGGTGAAGCCAGCGATTCTTGAA
Sequence Type mRNA
Unitrap ID UNI23413

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 29617813..29673448 146
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000010721 (Lmbr1) NM_020295 limb region 1 Gene [Source:MGI Symbol;Acc:MGI:1861746]

 
Come back to gene ENSMUSG00000010721


For any suggestions or comments, please send an email to unitrap@crg.es