Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST260737
Clone ID OST260737
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST260737
Sequence
AGTGGCAACAGGAGTCCAAAGAGAAGGTGGTGTCCCTCCTGCTGTCCCATCTGCCCCTGCTCCAGCCAGGCAACACGGAG
GCCAAGTCCGAGTACATGAGACTGCTGCAGAAAGTGCTGGCCTACTCCATCGAGAGCAATGCCTTCATTGAGGAGAGCCG
CCAACTCCTCTCCTATGCCCTCATCCACCCAGCCACCACACTGGAGGACCGCAATGCGCTAGCCCTCTGGCTGAGCCACC
TGGAAGAGCGGCTAGCTAGTGGTTTCCGCACCCGGCCAGAGCCCTCCTACCATTCACGCCAGGGCTCAGATGAATGGGGT
GGACCTGCAGAGCTGGCCCCTGGAGAGGCAGGGCCAGGCTGGCAGGACAAGCCACCCAGGGAAAATGGACACGTACCCTT
CCACCCATCCAGCTCTGTGCCGCCGGCCATCAACAGTATTGGGAGCAATGCAAACACAGGTGGGGGACATCTTCCTAGGT
GCCATATCTATTA
Sequence Type mRNA
Unitrap ID UNI6870

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 29198858..29199349 492
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037513 (Samd4b) NM_175021 sterile alpha motif domain containing 4B Gene [Source:MGI Symbol;Acc:MGI:2448542]

 
Come back to gene ENSMUSG00000037513


For any suggestions or comments, please send an email to unitrap@crg.es