Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST260495
Clone ID OST260495
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST260495
Sequence
GAACTGAGTATTCTTCCTTGTAAATACTGTTATTTGTATATACTGTAAATGATGACGTCGGTGGGCACTAACCGAGCCCG
GGGAAACTGGGAACAACCTCAAAACCAAANCCAGACNCAGCANACGCAGCCGGCACACAGGCCACATGCANANCNANTNC
CACTTGCACAGATGATTTCGGACCATAATGATGCTGACTTTGAGGAGAAGGTGAAACAATTGATTGATATCACAGGCAAA
AACCAGGATGAATGTGTGATTGCTTTGCATGACTGCAATGGAGATGTCAACAGAGCCATCAATGTTCTCCTGGAAGGAAA
TCCAGACACGCATTCCTGGGAGATGGTTGGGAAGAAGAAAGGAGTCTCAGGACAAAAGGATGGTGGACAAACTGAATCTA
ATGAANAAGGAAAAGAAAATCTTGACCGGGACAGANACTATAGTCGGCGACGTGGTGGGCCACCAAGACGGGGGAGAGGT
GCCAGCCGTGGACGAGAGTTTCGGGGCCAGGAAAATGGATTGGATG
Sequence Type mRNA
Unitrap ID UNI23420

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89842361..89851823 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042520 (Ubap2l) NM_028475 ubiquitin associated protein 2-like Gene [Source:MGI Symbol;Acc:MGI:1921633]

 
Come back to gene ENSMUSG00000042520


For any suggestions or comments, please send an email to unitrap@crg.es