Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST260444
Clone ID OST260444
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST260444
Sequence
ACTGAGGTGATCATGTGTCTGGCTGCANTCTCTGGGAGGCNGTAANGCCTNTNTNCATANNGGAGATAGNAGTGGCCNNT
CCNANGGCTCNTGACNTTCGGATTAAGATCCTTGCCACTGCTGTTTGCCACACCGATGCCTATACCCTGAGCGGAGCTGA
CCCCGAGGGGTGTTTCCCAGTGATCTTGGGACATGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGGGTCACGAAGC
TGAAGGCAGGTGACACTGTCATCCCACTCTACATCCCACAGTGTGGAGAATGCAAGTTTTGTCTGAATCCTAAAACAAAC
CTTTGCCAGAAAATAAGGGTCACTCAGGGGAAGGGATTAATGCCAGATGGGACTAGCAGATTTACCTGCAAAGGAAAGTC
TGTTTTTCACTTCATGGGGACTAGCACATTTTCCGAGTACACAGTTGTGGCTGACATCTCTGTTGCTAAAATCGATCCTT
CGGCCCCTTTGGATAATT
Sequence Type mRNA
Unitrap ID UNI23422

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 138108249..138114021 161
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028138 (Adh5) NM_007410 alcohol dehydrogenase 5 (class III), chi polypeptide Gene [Source:MGI (curated);Acc:Adh5]

 
Come back to gene ENSMUSG00000028138


For any suggestions or comments, please send an email to unitrap@crg.es