Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone SYA376
Clone ID SYA376
Vector pGT0Lxf
Project baygenomics

Sequence tag SYA376
Sequence
GCGGCCGGGTGACAACAGCAGCGGCGCCAGGCTGGCTTGCTAGCGGAAGGGTCGCGCGGCCCGCACAACAAACTCAGACC
CGGCCAGAATAAGGCGCGACGCGAGGAAGGCCGAGACGGGCCGCGCGGGAGACCGCGGGCGCGGAGTGACAGGCCGGCGT
GAGGGAGCGCGCAGGTTGCAGCCGCCGGCCGCCCGGACCCGCCGGGCCCCTCGGACGTCGCAGGCATGAGCCACATCCAG
ATCCCCGCGGGGCTCACGGAGCTGCTGCAGGGCTACACCGTGGAGGTGCTTCGGCAGCAGCCGCCCGACCTCGTCGACTT
CGCGGTGGAGTACTTCACACGCCTGCGCGAGGCCCGCCGCCAGGAATCAGACACGTTCATCGTCTCCCCGACGACCTTTC
ACACGCAGGAGTCCAGCGCAGTCCCCGTCATCGAGGAGGACGGGGAGAGTGACTCGGACTCGGAAGATGCCGATCTGGA
Sequence Type mRNA
Unitrap ID UNI5322

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108594563..108595041 479
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032601 (Prkar2a) NM_008924 protein kinase, cAMP dependent regulatory, type II alpha Gene [Source:MGI Symbol;Acc:MGI:108025]

 
Come back to gene ENSMUSG00000032601


For any suggestions or comments, please send an email to unitrap@crg.es