Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST260167
Clone ID OST260167
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST260167
Sequence
CACCCAGTGTCCAGATCAGGAGATTGACAGACCAGGTNAGCTCTGGGAAGTTAACCTGGATACGAAGAAACATCAGGATA
TTAGAGTGTGTGATTCCTGGGCTATGATGAAAGATTGAAAAATCTCTTGAAAAAAAGATGTATATTGGAAGTGTATAAAA
TTTTAACCATCTTATGGAGGAAGCATAAAGGGNGAAATGACCTAATCTAAAAGGNATTCAGTTTTTTGTTTGATTCTCCC
CCCCCCCCCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI12299

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 68847466..68847724 248
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034317 (Trim59) NM_025863 tripartite motif-containing 59 Gene [Source:MGI (curated);Acc:Trim59-001]

 
Come back to gene ENSMUSG00000034317


For any suggestions or comments, please send an email to unitrap@crg.es