Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST259778
Clone ID OST259778
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST259778
Sequence
TGAGGCTAAGATACTCACTTTCTGCTTGAAGCCGGGAATGAGATGTGTGGAACCCAGGAGTGTGTGTGGAGTAGACACCA
ATGCGTTGTGATAGTGAGGATTTTGAAGATACGACAGAAAAACCAGGCGTTTTGATTTCTGAGGTAAAAGTAGGCTGTAA
ATCTATTTTGTGAAAGGAGGGAAGACTCAGGCCAGAAATCTTGTATGCTATGGTTAACTGGTTCCCATCCTCCGAGAATC
CTGTTTTCCATGGTGTAAGACTTACTCAGCATCAGGATAAGGGATAACGACTCTATGGATATACAGAATCCTTCACCATG
GTAAAACTCGCTAACCCGCTGTACACGGAGTGGATTTTGGAGGCCATCAAAAAAGTCAAGAAGCAGAAACAGCGACCTTC
AGAGGAAAGGATCTGCAATGCCGTGTCCTCATCCCATGGGCTGGACCGCAGGACTGTGCTAGAGCAGCTGGAGCTGAGCG
TCAAAGACGGG
Sequence Type mRNA
Unitrap ID UNI23438

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 23972358..23972847 486
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031540 (Myst3) NM_001081149 MYST histone acetyltransferase (monocytic leukemia) 3 Gene [Source:MGI (curated);Acc:Myst3-002]

 
Come back to gene ENSMUSG00000031540


For any suggestions or comments, please send an email to unitrap@crg.es