Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST259768
Clone ID OST259768
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST259768
Sequence
TGAGAGAGCCGCTGCTCCCTGGGAACAACTTCACCAACGAGTGCAACATCCCAGGTAACTTCATGTGCAGCAACGGGCGG
TGCATCCCGGGCGCCTGGCAGTGTGACGGGCTGCCTGACTGCTTCGACAAGAGTGACGAGAAGGAATGCCCCAAAGCAAA
ATCAAAATGTGGCCCGACCTTCTTCCCCTGCGCCAGTGGCATCCACTGTATCATCGGCCGCTTCCGCTGCAATGGATTTG
AGGACTGTCCCGACGGCAGCGACGAGGAGAACTGCANNCTCTTTTGAGCAGGANGTGGATTACTTGNTNATAAACNGATT
NNCAAGGTGGGCCTACTGATTNCTTNCCNTTNAGAGNCCANGANAAAACCTCCCTACNNATCTTNATCAACAANGCTCTA
CTGAGGAGCTACANCCTGATGCCTCGCTGNGCATCGCTAGNGAGGCTGACTGTGTAGCAGCCTNTTTTATGGGAAACTGC
Sequence Type mRNA
Unitrap ID UNI12843

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 101901114..101953838 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048058 (Ldlrad3) NM_178886 low density lipoprotein receptor class A domain containing 3 Gene [Source:MGI (curated);Acc:Ldlrad3-001]

 
Come back to gene ENSMUSG00000048058


For any suggestions or comments, please send an email to unitrap@crg.es