Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST259534
Clone ID OST259534
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST259534
Sequence
GAACTGAGTGGTGAAGATCCAAGAAGGGAAGACGACTGTAATTGAAGGCCGAATCACAGAAACTCCCAAGGCGACTCCAG
ATCCCCCTAACCCCTCAGGCCAGTGCCCCATCTGCCGCTGGAACCTGAAGCACAAATATACCTATGAGGATGTGTTGTTG
CTCAGTCAGTTCATCCGGCCTTATGGAGGCATGCTGCCCCGGCGGGTCACAGGCTTGTGCCGGGAAGAACACCGAAAAAT
CGAGGAGTGCGTGAAGATGGCTCATCGAGCAGGTCTGTTACCAAATCACAGACCACAGCTTCCAGAAGGATGCTTACCAA
AGGATAAACCCAAGCTCAACCGCTATCTGACTCGCTGGGCTCCCAAGTCCGTCAAGCCCATCTATAAAAAAGGCCACCGT
TGGAACAAGGTGGGTATGGCCGTGGGGTCACCACTCCTGAAAGACAATGTCTGCTACTCCAGAAGGCCTCTGAAGATGAT
GCATTAGTGGGAGCAGGAC
Sequence Type mRNA
Unitrap ID UNI9576

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 46254887..46265610 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023967 (Mrps18a) NM_026768 mitochondrial ribosomal protein S18A Gene [Source:MGI Symbol;Acc:MGI:1915815]

 
Come back to gene ENSMUSG00000023967


For any suggestions or comments, please send an email to unitrap@crg.es