Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone SYA401
Clone ID SYA401
Vector pGT0Lxf
Project baygenomics

Sequence tag SYA401
Sequence
GAGACCAGCAGTGTGGTCAGGAAGATAGGGGGCACGGCCATCCAGCTGAATGTGTTTCAGTACTTGACTCGACTGCTTCG
GTCACTTGCCAGTGGAGGAAATGATTGCACCACGAGCACCGCCTGCATGTGTGTCTATGGTCTTCTCTCCTTTGCCCTCA
CCTCACTGGAGCTGCACACACTGGGCAACCAGCAGGATGTCATTGACACAGCATGTGAAGTCCTGGCAGACCCTTCCCTT
CCAGAGCTGTTCTGGGGAACAGAGCCAACCTCTGGTCTCGGGATCATTCTGGACAGTGTGTGTGGGATGTTTCCCCATCT
CCTTTCCCCACTTCTGCAATTGCTCCGAGCCCTCGTGTCAGGGAAGTCCACTGCCAAAAAAGTGTACAGCTTCCTGGATA
AAATGTCTTTCTACAACGAACTCCATAAGCACAAGCCCCATGATGTGCTCTCTCATGAAGATGGAACTCTGTGGCGGAGG
CAAACACCCAAACTCCCGTACCCTCT
Sequence Type mRNA
Unitrap ID UNI5346

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30165494..30172825 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052533 (Nup188) NM_198304 nucleoporin 188 Gene [Source:MGI (curated);Acc:Nup188-001]

 
Come back to gene ENSMUSG00000052533


For any suggestions or comments, please send an email to unitrap@crg.es