Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST258584
Clone ID OST258584
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST258584
Sequence
CATACCTGTCACAATGATTACCCTGATCTGGAGGAGGAGCTGTCCCAAAGACATGAACNTTCATGCNTGATCCAGATGTC
TGTGCTTTACTTCAAAAACATTGACTTGTTGGACAACAAAAAGTGAAAACTTGGATTGCAGCAGTGATTCACAGGCATTT
CCCTCATTGAATAATAAAGAACTAACAGGTATCAGAAACATTTCAAGCCAGGAAGGATCAACGGATGTTGTAGCCAGGAC
CCAGAAAGATGGCTTCCATATCTTCATTGTTTCTATTAAAACGGAGAAAACAGATGCAGTCTGGGATTTAAATGTTTCTC
TTTCTATGGTGGGTCCTCATGGGTACATCTCTGCATCAGACTGGCCTCTCATGATTTTTTATATGGTGATGTGTATT
Sequence Type mRNA
Unitrap ID UNI23459

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 128650211..128656995 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014353 (Tmem87b) NM_028248 transmembrane protein 87B Gene [Source:MGI (curated);Acc:Tmem87b-001]

 
Come back to gene ENSMUSG00000014353


For any suggestions or comments, please send an email to unitrap@crg.es