Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTA387
Clone ID YTA387
Vector pGT0Lxf
Project baygenomics

Sequence tag YTA387
Sequence
GCCATGGCTAGAGGTATTTGTTAGGGTGGCCAGCGCAGGGGGACTGCCTAGCTGAGAGCCGCACTGCTGGGAACGCAAGG
TGCGGGAGCGGCCGCTCACAGGCATCCTCCTATGGTGGAGCATGGGGATCCGGAGGGACAGGGGACTCTGGGTGCTACCG
GAGTACATTCCCCTTGTTGACCAGCGCTTGACTGTCTGGACGCGTGGGCGCCTGTGGTTCAGCCAGTCTTCCCGGAGCTG
GCATATCCGTATGTCAAAGCTCATGGAAACTTGAGCGCAGCGCCCCTCCAGGGAAC
Sequence Type mRNA
Unitrap ID UNI5356

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 124890012..124890307 296
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049327 (Setd8) NM_030241 SET domain containing (lysine methyltransferase) 8 Gene [Source:MGI (curated);Acc:Setd8-001]

 
Come back to gene ENSMUSG00000049327


For any suggestions or comments, please send an email to unitrap@crg.es