Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone SYA411
Clone ID SYA411
Vector pGT0Lxf
Project baygenomics

Sequence tag SYA411
Sequence
GACGGCCAACGTGCCTCAGACCGTGCCCATGCGGCTTCGCAAGCTGCCCGACTCCTTCTTCAAGCCGCCTGAGCCCAAGT
CCCACTCGAGACAGGCCAGTACTGATGCAGGTACTGCGGGAGCTCTGACTCCACAGCATGTTCGAGCTCACTCCTCTCCA
GCCTCCCTGCAGCTGGGTGCCGTTTCTCCTGGGACACTCACAGCCAGTGGCGTTGTCTCTGGCCCTGCCGCTGCCCCTGC
AGCTCAGCATCTCCGGCAGTCCTCCTTTGAGATCCCTGATGATGTACCACTGCCAGCAGGCTGGGAGATGGCCAAGACAT
CTTCTGGTCAAAGATACTTCTTAAATCACAACGATCAGACAACAACATGGCAGGACCCCCGGAAGGCCATGCTTTCGCAA
CTGAACGTTCCTGCGCCTGCCAGCCCAGCGGTGCCCCAGACGCTGATGAATTCTGCCTCAGGACCTCTTCCTGATGGATG
GGAGCAAGCCATGACTCAGGATGGAGAAGTTTACTACATAAACCATAAGAACAAGACCACATCC
Sequence Type mRNA
Unitrap ID UNI5357

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 7962320..8004208 254
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053110 (Yap1) NM_009534 yes-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:103262]

 
Come back to gene ENSMUSG00000053110


For any suggestions or comments, please send an email to unitrap@crg.es