Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST258399
Clone ID OST258399
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST258399
Sequence
ACTGAGAGAAGGGAAGGGAAGGGAAGAGGACGTAGAACTGAAGGCGGCCCTGGTCAAGTCCTCCTCCCGACTGCCCCTGT
CAGCAAGCAGCCTCAAGAGGGGTCCTGACCAGATGGAGGATGCCTTGGAGCCTGCAAAGAAACGGACACGAGTCATGGGT
GCAGTGACCAAAGTTGACACATCCCGTCCCAGAGGACCACTCCTCAGCACAGTGTCACAGACCCAGGGCCACAATGCAGG
TGGNCTGTNGAGGTGGGTGAGACCATANGGTGNGNGAAGTGTACTGCTCTCTCCCTCTTTTTTCTTTCCATTTGTATCTG
TCTCTGAGTGGATAATCCCCTTTCACTTCGTTCAGAACTCCAAAGGCACAAAGGTTGTTCGGTGGAGTTTGTACTTCCCA
CCTCTCGTCTTGGACACCTGGTTCTTCCAGGCTGCTGTGCATGCTAGGGGAGAGTTTGAGTAGACCAGGGTGAGGAAGCA
AGCGTGAACTGCTAACAGCACGCTGTATGCACAGCACGGCTGGCTTAGGCTTCTTACTCCAGA
Sequence Type mRNA
Unitrap ID UNI23466

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27057738..27058362 386
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024301 (AC144621.3-201) NM_053173 kinesin family member C1 [Source:RefSeq peptide;Acc:NP_444403]

 
Come back to gene ENSMUSG00000024301


For any suggestions or comments, please send an email to unitrap@crg.es