Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone SYA225
Clone ID SYA225
Vector pGT0Lxf
Project baygenomics

Sequence tag SYA225
Sequence
GGACCAATCACCCTTTGGGTGGATCATGGCATCTGCTTTACCCCCCAAACAAGGAGCTACCACAGTCCAAACAGTTTGAC
TTATGCCTCTTATTAGCGCTCATTAAACATCTGAATGTATTCCCTGCACCCAGAAAAGGCTGGGATATGGAACCACCATC
TTCTGATCTCTCTAAGTCTGCAGACATTCTGAGGCTCTGCAAGTACAGGGATATCCTTCTCAGTGAGATTCTGATGAATG
GTCTCACCGAGTTACAGTTCAATTCAATTTGGAAAAAAGTTTGTGATATTCTTGTGCGCCTTGGGATGAAACAAGACGAT
ATTGACAAAGTCAAGGAGAATCCCATTGAGAATATCTCCCCTGATTACCATCAGCTGATCTTTTATCTAGGCATAGCAGT
ACCAGAAATCATCCAGTGGATGTTATCACGCTATCAACAAGGAATTACTCTACAGTCAATAACAGGCAGTCAGC
Sequence Type mRNA
Unitrap ID UNI5379

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 48950114..48952096 421
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000064061 (Dzip3) NM_027341 DAZ interacting protein 3, zinc finger Gene [Source:MGI (curated);Acc:Dzip3-001]

 
Come back to gene ENSMUSG00000064061


For any suggestions or comments, please send an email to unitrap@crg.es