Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST257203
Clone ID OST257203
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST257203
Sequence
ACTGAGGAAGGATATGGAGAGAGNATTTAAAAGCTGACCCAAATGTACTGCTCAGCAGTTNTAGCCAAGAGGTCACAAAG
GATCTGCTAGACATGATTGACCATACAAGTATCCGAACTATTGAAGAATTGGCTGGAAAACTAGAATTTGAAAATGAATT
GAACCGTGTGTGTGGACACTGCCAAGATTCACCCTTCAAGGAGGAAGCCTGGGCCCTGCTTGTGGATGAGAGTCCTNAGA
AGGCTCTGGATGCTGACCCTGGTATCCTCAAGCAGGCTTTGGATGATCAGAATATAGTTGAGACTGTTCTGGACTTGGAA
GAAGACTACAANTTGATGACTTCTTTTAAATACCAAATAGAGTGAAGAGAGTGGATGTCAGCAGCCACAGNGGTTACCAA
AACAAGTCTT
Sequence Type mRNA
Unitrap ID UNI13219

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108297623..108299834 300
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032611 (1700102P08Rik) NM_053216 RIKEN cDNA 1700102P08 gene Gene [Source:MGI Symbol;Acc:MGI:2148248]

 
Come back to gene ENSMUSG00000032611


For any suggestions or comments, please send an email to unitrap@crg.es