Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST256009
Clone ID OST256009
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST256009
Sequence
ACTGAGCGGAGCGACTTTNAACAGCTGGCTGGNTGTTCGTCATATTGAAAAGTACGTAAACCAAGGTAAAAGTGGAACAA
GAGAATTGCTCTGGTCCTGGGCACAGAAAAACAAGACGATCGGCGACCTTTTAGAGGTTCTCCAGGACATGGGGCATCAA
CGAGCTATCCACTTAATCATCAACTATGGAGTAAGCTGGACTCCTTCAGTGCAGACGCATCACGAGCTTCCATTCCCCAG
CTTCCCACCTGAGGTGAAGCATGCGTGCAGAGAAAACGACCCTGGACCTCTGGAACCAGCCAATGTCACAGTGGATAATG
TTCTTGTTCCTGAACATAATGAAAAAGGAACACTGCAGAAAACCCCTATCAGCTTCCAGAGTATCCTAGAAGGAACCAAA
CATTTCCACAAAGACTTCCTGATTGGAGAAGGGGAGATATTCGAAGTATACAGAGTGGACATTCGAAACCAAGCATATGC
TGTTAAATTGTTTAAACAGGAGAAAAAAATGCAACTAAAGAAGCACTGGAAGAGATTTTTATCAGAACTGGAAGTTCTAC
TC
Sequence Type mRNA
Unitrap ID UNI23503

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 119607376..119619766 178
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020227 (Irak3) NM_028679 interleukin-1 receptor-associated kinase 3 Gene [Source:MGI Symbol;Acc:MGI:1921164]

 
Come back to gene ENSMUSG00000020227


For any suggestions or comments, please send an email to unitrap@crg.es