Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST255945
Clone ID OST255945
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST255945
Sequence
TTCCTGTATTCAACAAAGAGGAGGAAGAAGTGAGAAGATTCACCAGATTCTGGCCTTATATTTAATCCTAAGGGCACTAT
GGGTGCTGCTAGGTTGTTGTCTAGGATACTTTAGCCCATGACCATTTTGCTGCAGGAGGTAGAAACTGCTGGCCGAGACC
TGCCCTGATGTCTCTGCTGAGATTTCATCCCACTTGTGGGGTTTGTCGGGAGTGGGGGGTGTTCACAGTACCACTGTAGC
GTTTCCAAGAGCAAAATGTTTGTCATT
Sequence Type mRNA
Unitrap ID UNI13554

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 92112141..92112403 260
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039680 (Mrps6) NM_080456 mitochondrial ribosomal protein S6 Gene [Source:MGI (curated);Acc:Mrps6-001]

 
Come back to gene ENSMUSG00000039680


For any suggestions or comments, please send an email to unitrap@crg.es