Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone DC0086
Clone ID DC0086
Vector pGT1lxr
Project sanger

Sequence tag DC0086
Sequence
TGGGGAAAGCAAGCATTAAAGGAATCTCAGTTTACTTTATCCAAATGCATGGATGCAGTGATGGTGCTGGCGAATTCTCA
CCTGTTCATGAACCGCTCCAACCAGCTGGCTGTCATCGCCAGTCACATTCAGGAAAGCCGGCTCTTATACCCGGGGAAGA
ACGGTGGACTTGGAGACTTCTTCGGAGACCCTGGCAATGCGCTCCCCGACTGTAACCCCTCTGGGAGTAAAGATGGGAAA
TACGAGCTGTTGACAGCCGCAAACGAGGTGATCGCTGAGGAGATCACGGATCTGACGAGCCATAGAGGGACATCAAGGGC
CAGCATAGGGAGACACTAGGAGCAGGATCCAGGGCCAAAGAATCCGGGATACTTTCACAGATTGAACAAGGCAGTTAAAG
Sequence Type mRNA
Unitrap ID UNI459

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 125032507..125039409 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029387 (Gtf2h3) NM_181410 general transcription factor IIH, polypeptide 3 Gene [Source:MGI (curated);Acc:Gtf2h3-001]

 
Come back to gene ENSMUSG00000029387


For any suggestions or comments, please send an email to unitrap@crg.es