Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSJ073
Clone ID CSJ073
Vector pGT0Lxf
Project baygenomics

Sequence tag CSJ073
Sequence
GTCTTGTCCAGAGTGCCTGTCTCGGGAGGGCTCCCCCATTCCACATGATCCCGACTTGGGGTCAAAGTTAGCCTCTGTTC
CAGAGTACCGCTATTCCCAGAGTGCCCCAGGCTCCCCTGTCAGCGCCCAGCCGGTGATCATGGCTGTCCCTCCCCGACCT
TCCAACCTAGTGGCTAAGCCTGTCGCCTACATGCCAGCTTCCATAGTGACCTCACAGCAGCCCTCAGGCCACGCCATCCA
TGTGGTCCAGCAGGCCCCTACCGTCACCATGGTGAGGGTGGTTACCACCTCTGCCAACTCAGCCAACGGGTACATCCTGG
CTAGCCAGGGCTCGACTGGGACCTCCCACGACACAGCAGGCACAGCCGTGTTGGACCTGGGCAATGAGGCTCGAGGTTTG
GAAGAGAAGCCCACCATAGCATTTGCCACAATCCCCGCAGCCAGCCGAGTTATCCAGACGGTCGCCAGCCAGATGGCCCC
AGGAGTCCCCGGACACACAGTCACCATCCTACAGCCGGCTACACCAGTGACTATCGGGCAGCACCACCTTCCGGTCCGGG
CTGTCACTCAGAATGGAAAGCACGCTGTACCCACGAATAGCTTGACT
Sequence Type mRNA
Unitrap ID UNI5398

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 142929527..142931518 290
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056493 (Foxk1) NM_199068 forkhead box K1 Gene [Source:MGI Symbol;Acc:MGI:1347488]

 
Come back to gene ENSMUSG00000056493


For any suggestions or comments, please send an email to unitrap@crg.es