Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSJ090
Clone ID CSJ090
Vector pGT0Lxf
Project baygenomics

Sequence tag CSJ090
Sequence
TTGCTTCCTGTTTGTCGGACGAGGAGACATGGCGGCAGCGCCCGCAGCGGCTGGAGCTGGGGCCAGCCGGGGGAGGCGGT
TGGCAGCTACCGCGGCGGCGTGGGGCGGCTGGGGAGGTCGACCGCGGCCGGGTAACATCCTGCTGCAGCTGCGGCAGGGC
CAGCTCACCGGCCGAGGCCTGGTCCGGGCGGTGCAGTTCACTGAGACCTTTTTGACCGAGAGGGACAAATTGTCCAAATG
GAGTGGAATTCCTCAGTTGCTCCTTAAGCTGTATGCCACCAGCCATCTGCACAGTGACTTCGTTGAGTGCCAAAGCATTC
TCAAGGAGATTTCTCCTCTTCTCTCTATGGAGGCTATGGCGTTTGTAACTGAAGACAGGAAATTTACTCAAGAAGCTACA
TACCCAAATACATATATTTTTGACTTATTTGGAGGTGTTGATCTTCTTGTAGAAATTCTTATGAGGCCTACCATCTCTAT
CCGGGGACAG
Sequence Type mRNA
Unitrap ID UNI5400

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 155496776..155518070 196
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038324 (Trpc4ap) NM_019828 transient receptor potential cation channel, subfamily C, member 4 associated protein Gene [Source:MGI (curated);Acc:Trpc4ap-002]

 
Come back to gene ENSMUSG00000038324


For any suggestions or comments, please send an email to unitrap@crg.es