Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0353
Clone ID GC0353
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0353
Sequence
CTACAATGAACCGAATGACAAACTTCTTGATGGCCTTATCCTTGGGCACGCACCGGGCGCAGTTCGAGCAGCGAATGGGC
TGCACATGGCCGCGGCCCCCCCCGC
Sequence Type mRNA
Unitrap ID UNI86

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 128063164..128063261 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025362 (AC117232.3) NM_013765 40S ribosomal protein S26 [Source:UniProtKB/Swiss-Prot;Acc:P62855]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 48913930..48914027 92
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109963327..109963424 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059775 (Rps26) NP_038793 ribosomal protein S26 Gene [Source:MGI Symbol;Acc:MGI:1351628]

 
Come back to gene ENSMUSG00000059775


For any suggestions or comments, please send an email to unitrap@crg.es