Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST255506
Clone ID OST255506
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST255506
Sequence
CCCCGTGGTTTAATGGNTGGGGCTTTAACCTACCCANNGCCAGTCTCTGCTGGACAAATGGGAACCTAATCCCTGGGGGC
ATCGACATACTCATGACACACGGGACCTCCTCTAGGTTTTCGAGACTGGGTTCCAAAGGAACTTCAAAGGGTGGGCTGCG
TGGAGCTCTTAAACACAGTCCAGAGGCGCATTCGGCCCAAGCTCCATGTGTTCGGTGGGATTCACGAAGGGTACGGCATC
ATGACCGATGGTTACACCACCTACATCAATGCCTCAACCTGTACAGTCAGCTTTCAACCGACCAACCCTCCAATCATATT
TGACCTTCCAAACCCACAGGGCTCCTAAAGCACTCAGCATCCCGTTGGAATGTGAGGGACGGTCTACAAACTGCCATTTT
TCTAATTATAAACTCACATTCTCTGATTTGTTTATTTCTAAATCCTGTGAGTTCTTTTTGTAAATTGTTGGAACAGGAGG
GAAAAGAA
Sequence Type mRNA
Unitrap ID UNI21575

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 106701647..106707363 259
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000016386 (Mpped2) metallophosphoesterase domain containing 2 Gene [Source:MGI (curated);Acc:Mpped2-001]

 
Come back to gene ENSMUSG00000016386


For any suggestions or comments, please send an email to unitrap@crg.es