Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST255410
Clone ID OST255410
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST255410
Sequence
ACTTGGCCTCCCAAACGACCATCCTGCCCCTGCTGTTTGGCTGCCTGGGGATTTTCAGCCTCTTCAGGCTGCTGCAGGAG
GATCCGCTCAAAGGCTTACCTGAGGAATGCTGTGGTGGTAGTCACGGGCGCCACCTCAGGTCTCGGCAGAGAATGTGCCA
AAGTCTTCCATGCTGCGGGGGCTAAACTGGTCCTCTGTGGACGAAATGTGAAGGCCCTGGAGGAGCTCAGCCGGGAACTT
GCTGGTTCTTCTCAGGGACAGACACACCAACCCTTCGTGGTGACCTTTGACCTCGCGGATCCTGGTACTATTGCTGCTGC
AGCAGCTGAGATCCTCCAGTGCTTTGGCTATGTGGACGTTCTCATCAATAATGCTGGGATTAGCTACCGTGGNACCATTA
GTGATACCATAGTGGACGTGGACCGGAAGGNGATGGAAATAAACTACTTTGGCCCTGTTGCTCTAACAAAAGCGCTCCTA
CCCTCCATGGTGGAAAGGAAGCAAGGCCACATCGTCGCCATCAGCAGCATCCAGGGCAAGATAAGCATTCCTTTCCGATC
GG
Sequence Type mRNA
Unitrap ID UNI15902

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 60657696..60666010 216
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042569 (Dhrs7b) NM_145428 dehydrogenase/reductase (SDR family) member 7B Gene [Source:MGI (curated);Acc:Dhrs7b-001]

 
Come back to gene ENSMUSG00000042569


For any suggestions or comments, please send an email to unitrap@crg.es