Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSJ111
Clone ID CSJ111
Vector pGT0Lxf
Project baygenomics

Sequence tag CSJ111
Sequence
GGGGACTTCAGGCTCCAGTGACCAGGAGGCCCGCAGGAGCCCTGGAAGCCGTCGTTGCCAAGGGCTGGCGGTGGCGGTTT
TTTCTTTTTTTTCAGAGGAAGAGGAGAAAGGCGCAGGGGTTGGAGTTTTCCCCGGGGATCGATGTGGACTTTTTTTTTTT
TTTTTGGTCTGTGGAACGAAATGGTTAAAGATGGGGAAATTGTGTACACTGGAACAGAATTAGCACAAAATCGAGAACTC
CCTTGAGAAA
Sequence Type mRNA
Unitrap ID UNI5407

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 63323380..63323466 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030451 (Herc2) NM_010418 hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 2 Gene [Source:MGI Symbol;Acc:MGI:103234]

 
Come back to gene ENSMUSG00000030451


For any suggestions or comments, please send an email to unitrap@crg.es