Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST254950
Clone ID OST254950
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST254950
Sequence
AGTCCTGTAAATGCAATGGCTGGNANAACCCTAACCCCTCTCCTACTCCACCAAGGAGGGAGACCTCCAGCAGNATAATT
GTCAGTTTGACAGAATCCTGTCGAAGCTGTAGCCATGCCCTTGCTGCTCACGTTTCTCACTTGGGAGAATGTGTCAGAGG
AAGAGATGGACAGACTCCTGGGAATTGTGTTGGATGTGGAGTACCTCTTCACCTGCGTCCACAAAGAAGAAGATGCAGAT
ACCAAACAAGTGTACTTCTACCTATTCAAGCTCTTGAGAAAGTCAATTTTACAAAGAGGAAAACCTGTGGTTGAAGGCTC
CTTGGAGAAGAAGCCGCCATTTGAGAAGCCCAGTATTGAACAGGGTGTGAACAACTTCGTGCAGTACAAGTTTAGTCACT
TGCCATCGAAAGAGAGGCAGACAACGATCGAGCTGGCCAAGATGTTTCTGAACCGCATCAACTACTGGCATCTGGAGGCT
CCATCTCAGCGGAGACTACGGTCTCCCAATGATGACATCTCTGGATACAAGGAAAACTACACAAGATANTACNGGACGAA
AAGAATNGAAAAATCAAAGACGGCCAG
Sequence Type mRNA
Unitrap ID UNI22239

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 53750196..53772046 186
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000708 (Kat2b) NM_020005 K(lysine) acetyltransferase 2B Gene [Source:MGI Symbol;Acc:MGI:1343094]

 
Come back to gene ENSMUSG00000000708


For any suggestions or comments, please send an email to unitrap@crg.es