Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST254699
Clone ID OST254699
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST254699
Sequence
CGCATCCTTACACTGGGCAGCCTCCTCTGGCTGCGCCTCAAGTGTCCTTCTGCTGTGTGACCACGAAGCCTTCCTGGGCG
TGCTGGATAATGATGGACGCACACCCCTGTTGATTGCATCGCTGGGTGGNCATGCANCTATCTGCTCACANCTGTTGCAN
AGAGGNGCCCGAGTTAATGTNACAGACAAGGNTGACAAANCAAATTTGATCCTGGCCTGTGAGAAAGGCAGNGCTGAGGG
GGNCNANCTGCTNCTGAGCCANGGNAGCGGACGCTGGAGCGGNGGACAGGTTGGGACACAACGCTCTT
Sequence Type mRNA
Unitrap ID UNI23525

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96484547..96486058 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038354 (Ankrd35) NM_001081139 ankyrin repeat domain 35 Gene [Source:MGI (curated);Acc:Ankrd35-001]

 
Come back to gene ENSMUSG00000038354


For any suggestions or comments, please send an email to unitrap@crg.es