Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSJ178
Clone ID CSJ178
Vector pGT0Lxf
Project baygenomics

Sequence tag CSJ178
Sequence
CCCAGGCTGCGGCGGCGGCGACGGCGATGGTGGCGGGGCGCTGGTGCTGCGCGGCGTAAGGCACGCCGGCCGTTCAGGGT
CGCGAGCGCGCGTGGGCCGCGATCGGGTGCTCGGAGCCGGGTCCAGCCGAGCCAGGCTCAGCCTCACGCTCCGCGGCGGC
GGTGTTGACAGACGCCCTCCTGAGGAGAGCCGCCCGGCCCGCCTCAGCCTCACCCGGCCGAGCGCTGTTCCCCAGCCCCG
CGCCAGCGAGTCCGGGACCTGGCCGCACGGGGCCTGCGGACTCG
Sequence Type mRNA
Unitrap ID UNI5427

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70351267..70351550 284
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032217 (Rnf111) NM_033604 ring finger 111 Gene [Source:MGI Symbol;Acc:MGI:1934919]

 
Come back to gene ENSMUSG00000032217


For any suggestions or comments, please send an email to unitrap@crg.es