Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST254234
Clone ID OST254234
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST254234
Sequence
AAACTACAAGGAGCAAGNACAAACAGCAGNAAAGTGGNAGTTTCGGGAAAAGGGATGGAAGAAAAGNAGGTGTCTGATTT
CATCCAGGGACAGTGGACAGGTCAAGAAAAAGTTTCAGCCTATGAACAAGATAGAGCGGAGCATACTACATGATGTGGTA
GAGGTGGCTGGCCTCACATCCTTCTCCTTTGGAGAAGATGATGACTGTCGCTATGTCATGATCTTCAAAAAGGAGTTTGC
ACCCTCAGATGAAGAGCTAGACTCCTACCGTCATGGAGAGGAGTGGGACCCCCAGAAGGCTGAGGAGAAGCGGAAGCTAA
AGGAGCTGGCTCAGAAGCANGAGGAAGAGGCAGCGCAGCAGGGACCTGCGGTTGTGAGTCCTGCCAGCGACTACAAGGAC
AAGTATAGCCATCTTATTGGCAAAGGAGCAGCCAAAGATGCAGCCCACATGCTACAGGCCAACAAGACCTATGGCTGTGT
TCCTGTGGCCAACAAGCGGGACACACNGGTCCATAGANGAGGCCATGAATGAGATCAGAGCCAAGAAACCCCTGCGGCAN
AGTGGNGAAAAAGTTGCCCAACTACCTCCTAGGCATTCCNCCCACCTTGGNTTTGACCTNCAGNCAAGGCAGGGGCATGG
G
Sequence Type mRNA
Unitrap ID UNI23531

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 70477567..70478579 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018287 (Spag7) NM_172561 sperm associated antigen 7 Gene [Source:MGI (curated);Acc:Spag7-001]

 
Come back to gene ENSMUSG00000018287


For any suggestions or comments, please send an email to unitrap@crg.es