Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSJ183
Clone ID CSJ183
Vector pGT0Lxf
Project baygenomics

Sequence tag CSJ183
Sequence
TTTGGGCCACCTGCTGCTGACACTGTAGGCGTTGCCATGCGGGTTCCTACAATGGGTGCTAGTTCTGGAGAGCTGGCGCC
CCGAGGTCCTCTGGGCTGTGCCCCCTGCTGCCCGCCTAGCACGTCTCATGTGTGTGTACCTGGTGGATAGCGAGCTGTTT
CGAGAGACTCCCATACAGCGACTGGTGGCAGCTCTTTTAGCTCGGCTCTGTCGGCCCCAAGTCTTGCCAAACCTCAAGCT
GGACTGCCCCCTCCCTGGCCTGACCTCTTTTCCTGACCTTTATGCCAGCTTGTTAGACCATCCTGAGGCTGTCTCTTGTG
GGGACCACTTGTTTGGGGCCCTGGTC
Sequence Type mRNA
Unitrap ID UNI5432

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 119593327..119593669 332
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034032 (Rpap1) NM_177294 RNA polymerase II associated protein 1 Gene [Source:MGI (curated);Acc:Rpap1-006]

 
Come back to gene ENSMUSG00000034032


For any suggestions or comments, please send an email to unitrap@crg.es