Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST253953
Clone ID OST253953
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST253953
Sequence
CTCCTGAGCCCTTGCCGCTGTGACGGNTCAGTGCGTTGCACACACCAACCCTGCCTAATCCGCTGGGANNAGTGAGAGGG
GCTCATGGAGCTGTGAGCTTTGCTACTTCAAGTACCAGGTCCTGGCGATCANCACCAAGAATCCACTGCAGTGGCAGGCC
ATCTCCCTGACCGTNATCNAGAAGGTCCANATTGCTGCTATCGTCCTGGGATCGCTGTTCCTNGNGGGGNGNATCTCCTG
GCTCATCTGGNCCTCGCTCAGCCCTTCAGCCAAGTGGCAGCGCCAGGACCTCCTCTTNCANATTTGCTATGGCATGTACG
GCTTCATGGATGTCGTCTTCATANGCCTCATCGTCCACGAAGGGNCTTCTGTTTACCGNATCTTNAATCGCTGGCAGGCC
GTGNACCACCAGTGGAAAGTNCTGNNCTATNACAAGACCAAGGACGTGGGAGGAGACACAGGGGGAGGGGCGGCAGGGAA
NCCAGGCCCCAGGACCT
Sequence Type mRNA
Unitrap ID UNI23537

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 126493815..126495425 167
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040502 (March9) NM_001033262 membrane-associated ring finger (C3HC4) 9 Gene [Source:MGI (curated);Acc:March9-001]

 
Come back to gene ENSMUSG00000040502


For any suggestions or comments, please send an email to unitrap@crg.es