Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST253814
Clone ID OST253814
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST253814
Sequence
CAGCACAGTTACACTGCCTGAGCACCTTGTTGTTTGTCTCGACCCTGGNATGGAAGCTTGCATGCTGTTAGCAAGGAGGA
CGGGCTCCATCAAGTGGACTTTAAAAGAAGATCCAGTCCTGCAGGTCCCAACACACGTGGAAGAGCCGGCTTTCCTCCCA
GTATCCCAATGATGGCAGTCTGTACACACTTGGAGGCAAGAACAACGAA
Sequence Type mRNA
Unitrap ID UNI23541

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106296238..106320328 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020715 (Ern1) NM_023913 endoplasmic reticulum (ER) to nucleus signalling 1 Gene [Source:MGI (curated);Acc:Ern1-001]

 
Come back to gene ENSMUSG00000020715


For any suggestions or comments, please send an email to unitrap@crg.es