Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST253779
Clone ID OST253779
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST253779
Sequence
ATACACCCATGCAGCCAACACAGTCGTTTACAGCTCTAACAAAATAGCACGATACTATTCNTTACTNGTNCTTGCNTGAC
AATAAATACATCAGATACTTT
Sequence Type mRNA
Unitrap ID UNI21102

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106078992..106082946 48
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020257 (Wdr82) NM_029896 WD repeat domain containing 82 Gene [Source:MGI Symbol;Acc:MGI:1924555]

 
Come back to gene ENSMUSG00000020257


For any suggestions or comments, please send an email to unitrap@crg.es