Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSJ197
Clone ID CSJ197
Vector pGT0Lxf
Project baygenomics

Sequence tag CSJ197
Sequence
GGAGTCCGGCGGCTGCTCTGGAGCAGCGTGTGGCTGCGAGGGACAGCAGAGTCTAACGGAGCCATGCCCACGAACTTTAC
GGTGGTGCCGGTGGAGGCGCGCGCCGACGGCGCCGGGGACGAAGCTGCTGAGCGCACGGAAGAACCCGAGTCTCCCGAGA
GCGTGGATCAAACCTCCCCTACGCCG
Sequence Type mRNA
Unitrap ID UNI5423

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 73901152..73901337 186
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017756 (Slc12a7) NM_011390 solute carrier family 12, member 7 Gene [Source:MGI Symbol;Acc:MGI:1342283]

 
Come back to gene ENSMUSG00000017756


For any suggestions or comments, please send an email to unitrap@crg.es