Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST253606
Clone ID OST253606
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST253606
Sequence
ATTTGCAGGGCTACATGGNCTCCTGGTGGCTGTGGGCTCTTCGTGCCGCTTTCTTCAGGGAGCAGGGAACACCGGAGCTG
AGGCCACCACATTGCACGCAGCTCCCCAGGGTGCAGCTATGGCTGTCAGCACCTTCCGAAAGCTAGATGGGATATGTTGG
CAGGTACGCCAACTCTTTGAGAACACAGGGGTCCCTGGCCGCTTCTTGTTCCAAGTCTCACGGGCCCGTGGACCAGTGCA
TATGGTGGTTGCTGAGACTGACTATCAGAGCTTTGCCATCCTGTACCTGGAACAGGGAAGGAAGCTGTCTGTGAAACTAT
ACGTCCGCTCACTGCCAGTGAATGACTCTGTCCTGGATGTGTTTGAGCGGCGAGTCAGGGAAGCCAACCTGACAGAAGAT
CAGATTCTTTTCTTTCCCAAGTATGGTTTCTGCGAGACTGCGGACCAATTACACATCCTGAACGAGGTGCCGCGATAAGG
CCATCTAGTGGAGAAGCTGTGGACAGTGGGCTACCCTCANAGAGTTCTGAGCATCCTGAATGCACTCTTGGAGTCTCTCC
TTTCTGTCCCCAGAAGCACCCCTTCATAT
Sequence Type mRNA
Unitrap ID UNI23555

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 25354220..25355495 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015083 (C8g) NM_027062 complement component 8, gamma polypeptide Gene [Source:MGI (curated);Acc:C8g-002]

 
Come back to gene ENSMUSG00000015083


For any suggestions or comments, please send an email to unitrap@crg.es