Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST253339
Clone ID OST253339
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST253339
Sequence
CTGAGGCACAGAGCCAGCCTNTTCCCCACCTACCTGCCTTCCAGTCTACCAGGAAAGATGTGTGATCCAACATCTGAAAG
TCAGTTATGGAGAAGCAGCAGCCAGATCCCTTCCCCGTGTCTTATCTGTAGACTTGACCACATTGTGATGACTGTAAAGA
ACATTGAAGACACCACCATGTTTTATTCCAAGATCCTGGGCATGGAGGTCACTACTTTCAAGGGAAACCGGAAAGCATTG
TGTTTCGGAGACCAAAAATTTAACTTACACGAGGTGGGAAAGGAATTTGACCCCAAAGCAGCTCACCCTGTTCCAGGCTC
CCTGGATGTTTGTTTGATCACAGAAGCACCCCTGGAGGAGGTGATCGAGCGCCTAAAGGCTTTTGATGTCCCCATTGAAG
AGGGCCCAGTATTCAGAACAGGAGCAAAGGGGCCTATTCTATCCATCTACTTCCGAGATCCGGACAGAAATCTCCTTGAG
GTGTCCAGCTATGTCACTTCATGATTGACACTGGCTTTTTCTTCTATTG
Sequence Type mRNA
Unitrap ID UNI13511

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7581478..7595624 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031163 (Glod5) NM_027227 glyoxalase domain containing 5 Gene [Source:MGI (curated);Acc:Glod5-001]

 
Come back to gene ENSMUSG00000031163


For any suggestions or comments, please send an email to unitrap@crg.es