Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST252919
Clone ID OST252919
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST252919
Sequence
GAGCTTCAACATCCAGGCCAGGTCTCTGCCTCAGAAAGTCAGTGCGACCGCCATTGTCCCCTGCCTCTCACCTCCTGGGT
CACTGGTATTTGAGGATTTTGCTAACCTGACACCCTTTGTCAAGGAAGAGCTGAGATTCGCCATCCAGAATAAACACCTC
TGCCATCGGATGTCCTCTGCGCTGGAGTCAGTTACCGTCAACAACAGACCCCTGGAGATGTCAGTCACCAAGTCTGAGGC
GGCCCCTGAAGAANATGAGAGGANAAGGAGGCTGGCGAGANAGAAATAAAATTGCTGCTGCCAAGTGTC
Sequence Type mRNA
Unitrap ID UNI23566

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 192996292..193001344 234
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026628 (Atf3) NM_007498 activating transcription factor 3 Gene [Source:MGI (curated);Acc:Atf3-001]

 
Come back to gene ENSMUSG00000026628


For any suggestions or comments, please send an email to unitrap@crg.es