Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST252901
Clone ID OST252901
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST252901
Sequence
AAAGCCAAGCAGACTAAACAGGACAAAGAGAAGATTGCGTGATGTGGTATTGCTGCAGAAGCTGCAGCACGCAGCCCAGA
TGGAGCAGAAGCAAAATGACACAGAGAACAAGAAGGTGCACGGGGACGTGGTGAAGTACGGCAGCTGTGATTCAGCTTCT
GCATATGAAGAGCAACAAATACTTAACTGTGAACAAGCGGCTGCCAGCCCTGCTGGAGAANAATGCCATGCGGGTGACGC
TGGATGCTACNGGCAATGAGGGCTCCTGGCTCTTCATCCAGCCCTTCTGGAAGCTTCCT
Sequence Type mRNA
Unitrap ID UNI20735

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27220531..27223925 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042644 (Itpr3) NM_080553 inositol 1,4,5-triphosphate receptor 3 Gene [Source:MGI (curated);Acc:Itpr3-001]

 
Come back to gene ENSMUSG00000042644


For any suggestions or comments, please send an email to unitrap@crg.es