Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSJ252
Clone ID CSJ252
Vector pGT0Lxf
Project baygenomics

Sequence tag CSJ252
Sequence
TGCCATGGCATTTATCCAGGGCACCTCAAGGACTCCTCCATCTGTGGACGGGAAACGAACTCAGCAGGCCTGTTTTTTTG
AAGACAGAGATTTTGGTTACAGTGTGGGCTTGAACCCTCCAGAAG
Sequence Type mRNA
Unitrap ID UNI5456

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 110663568..110663692 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029501 (Ankle2) NP_082198 ankyrin repeat and LEM domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1261856]

 
Come back to gene ENSMUSG00000029501


For any suggestions or comments, please send an email to unitrap@crg.es