Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST252808
Clone ID OST252808
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST252808
Sequence
GACTGAGGTTTAGAAGGATCCAGCCCGAGGCTAAGGTGGTCACAGAAGGGAGAGTCAGCCATCTGCAGCTAGGAGATATG
CTTAAAGGAAAGACTCAGCAGCAAGGAGCTGGGGTGTGATGGCCGGCTCCCACGTGGACATGGCGCCAGCTTCCACCACC
GAGGGAACTGGGGAAAAGCCAGGGCCCACTGCGCCAGCACCCACCCCAGCTGCTCAGTATGAGTGTGGGGAATGCCGGCA
AGTCCTTCAGGTGGTCATCTCGGCTCCTGCACCATCAGCGCACTCACACAGGNGANCGNTCCTATAAATGCTCGGACTGC
CNNAAANCNNTTANGGGNNCCTGAANCTTCCTGTANCACCAGCGGNGCCATACAGGNGANCGNNCCTATNAANGCCCACA
CTGNCCCANNGCCTTTNAGCGCTNTTTCTTGCTGCAGATCCACCGCAGTGCTGCACACNNGCTCTGTNGNNCTTGACCTG
NNNNCAGAGTGGTCTGNNCTTCCAGNGGTCATCCCATTACCAATACCACTTGAGACAGCATACCGGT
Sequence Type mRNA
Unitrap ID UNI23571

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4869010..4870808 319
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074406 (Zfp628) NP_739565 zinc finger protein 628 Gene [Source:MGI Symbol;Acc:MGI:2665174]

 
Come back to gene ENSMUSG00000074406


For any suggestions or comments, please send an email to unitrap@crg.es