Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSJ202
Clone ID CSJ202
Vector pGT0Lxf
Project baygenomics

Sequence tag CSJ202
Sequence
CCAGTGGTGGGTGGCGTGGGCCTGTGACCAGGAGGTGCCCTCGGGCCCAGGCACCCTGAGCCAAGGCCCTCCTCCAGGGG
AGAGCAGCGAACCCGAGGCAAAGGTCCTCCACACCAAGCGGCTTTACCGGGCTGTGGTGGAGGATGTGCATCGGCTAGAT
CTCATCCTTTGCAACAAAGCTGCTTATCAGGAAGTGTTCAAACCAGAGAACGTTAGCCTGAGGAACAAGCTACGAGAGCT
CTGTGTGAAGCTTATGTTCTTGCATCCAGTAGACTATGGGAGGAAGGCTGAGGAACTGCTGTGGAGAAAGGTATACTATG
AAGTTATCCAACTTATCAAGACTAACAAAAAGCACATCCACAGTCGGAGCACCTTGGAATGTGCCTACAGGACTCATCTG
GTCGCTGGCATTGGCTTCTACCAGCATCTCCTTCTCTATATCCAGTCCCACTACCAGCTGGAACTACAGTGCTGCATCGA
C
Sequence Type mRNA
Unitrap ID UNI5460

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88140291..88146930 131
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001415 (Smg5) NM_178246 Smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2447364]

 
Come back to gene ENSMUSG00000001415


For any suggestions or comments, please send an email to unitrap@crg.es