Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST252729
Clone ID OST252729
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST252729
Sequence
GACTGAGGTGCCAGGAGCAGTACCCAGGCTGCTCTGGCTCCAGTGAGGATGAAGCGGCCAGTGAGGCCCGGAGCACCACC
AGTGACTGTCCCAGCCTTCTCAGCACCACCACAGAGGACTGCCTGGGTGGCGAAGCGGTGGACGAACAGAGCCAGCAGGA
AAACCTGGAGGAGAAGCTGAAAGGTTATGTGGACTGCCTGACTGACAAGAGTGCCAAGACCCGTCAAGGAGCCCTGGAGA
GCCTGCGCCTGGCCCTGGCCTCCCGCCTACTTCCGGACTTTCTGCTGGAGCGCAGCCTCACTCTGGCGGATGCCCTGGAA
AAGTGCCTTAAGAAAGGGAAGGGTGAAGAACAGGCTCTGGCTGCTGCTGTGCTAGGCATTCTCTGTGTGCAGTTGGGCCC
TGGACCCAAGGGCGAGGAGCTGTTCCGTAGCCTGCAGCCCTTGCTCATCTCGGTGCTCAGTGACAGTACAGCAAGCCCCA
CTGCCCGGCTCCATTGNGCTTCTGCTCTTGGCTTGGGTTGCTATGTGGCTTGCCACCGACGTCCA
Sequence Type mRNA
Unitrap ID UNI5891

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 107492232..107493176 160
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000010048 (Ifrd2) NM_025903 interferon-related developmental regulator 2 Gene [Source:MGI Symbol;Acc:MGI:1316708]

 
Come back to gene ENSMUSG00000010048


For any suggestions or comments, please send an email to unitrap@crg.es