Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST252481
Clone ID OST252481
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST252481
Sequence
GGGGTAAAAAAGCATCAAGTCGCCTTGCCTGGGCAGGAGGAACCCTGGGATATACGGAACCTCCTTGTCTGGATCAAGAA
GAATTTGCTAAAAGAGCCGACCAGAGCTGTTCATCCAGGGAGACAGTGNGCNGGCCAGGAATCCTGGCGCTGANTAATGA
TGCCGACTGGGAACTGCTGGGGGAGCNTGGACTACCAGCTGCAGGACCAAGACAGCATNCTCTTCATCTNCACACTGCAC
GGGGGCTGAGGCCTCCCCAGTGGGCCCAAGCNCCTTTGCNGGGGAACACAGGACANCCACAGCNCTCCTCNATNTGCTTN
CAGGNCCTCAGTCCCCCTTGNCTGCCTCCTTCCCTGATGTACCCCTGGAGCTTCCTNTAGGCAGGGAAAAGAG
Sequence Type mRNA
Unitrap ID UNI370

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29688237..29698834 179
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069020 (Urm1) NM_026615 ubiquitin related modifier 1 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Urm1-001]

 
Come back to gene ENSMUSG00000069020


For any suggestions or comments, please send an email to unitrap@crg.es