Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSJ270
Clone ID CSJ270
Vector pGT0Lxf
Project baygenomics

Sequence tag CSJ270
Sequence
GAATGTGCACATTTTCATTATGAGAACGTGGAGTTTGGCAGCATACAGCTCTCACTATCAGAAGAACAGAATGAAGTAAT
GAAAAATGGCTGTGAATCTAAAGAGCTGGTCTACCTCGTGCAGATTGCCTGTCAGGGCAAAGAGTTGGATTGTTAAAAGA
AGTTATGAAGATTTTCGGGTACTCGACAAACATCTTCATCTCTGCATTTATGACCGCCGATTCTCCCAGCTCACAGAGCT
TCCCCGCTCTGACGTCCTGAAGGACAGTCCTGAGTCGGTTACTCAGATGCTTACAGCTTACCTGTCACGCCTTTCAACTA
TCGCTGGCAACAAGATCAACTGTGGGCCTGCCCTTACCTGGATGGAGATCGACAATAAGGGAAACCATCTTCTAGTTCAC
GAGGAGTCGTCCATCAACACTCCTGCTGTCGGTGCTGCCCATGTTATCAAGCGCTACACCGCTCGGGCCCCTGATGAACT
GACATTAGAGGTGGGAGACATCGTTTCTGTTATTGACATGCCTCCCAAAGTATTAAGCACATGGTGGAGAGGCAAGCATG
GATTTCAGGTGGGACTCTTCCTCTGGTCATTGTGTCGAGTTAATTAACCAGAAAGTTCCTCAGTCAGTAACCAACTCAGT
GCCAA
Sequence Type mRNA
Unitrap ID UNI5466

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 31960662..32015844 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041444 (Grit) NM_177379 Rho GTPase-activating protein Gene [Source:MGI Symbol;Acc:MGI:2450166]

 
Come back to gene ENSMUSG00000041444


For any suggestions or comments, please send an email to unitrap@crg.es