Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST252387
Clone ID OST252387
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST252387
Sequence
GGCTTCATTCATACAGTATGAACCAAGCATTGGNATAGCAGTNTAAAANTAGAATCAGACAGCTGACTGCTCANCAGGAT
GCCATCAACTAACAGAGCAGGCAGTCTAAAGGACCCTGAAATTGCAGAGCTCTTCTTCAAAGAAGATCCAGGAAAAGCTC
TTCACAGATCTCAGAGAAATCGGCCATGGNAGCTTTGGANCAGNATNTTCTGCACGAGATGTGCNTNCTANATGAAGTGG
TGGCCATCAAGAAACATGTCTTATAGAGGAATGCAGTCTACTGAGAAATGGCAGGATATTATTAAGGAAGTCATAGTTTC
TACNAANAATAACACATCCCANCAGNATANAATACAAAGGCTGCTATTTACNTGAACACACAGCATGGCTTGGAATGGAA
TATTGTTTAGGATCTGCTTCAGATTTATTAGAAGTTCATAAAAAGCCATTACAAGAAGTGGAAATAGCA
Sequence Type mRNA
Unitrap ID UNI23588

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77389137..77398983 186
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017291 (Taok1) NM_144825 TAO kinase 1 Gene [Source:MGI (curated);Acc:Taok1-001]

 
Come back to gene ENSMUSG00000017291


For any suggestions or comments, please send an email to unitrap@crg.es