Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST252296
Clone ID OST252296
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST252296
Sequence
TGAGATCTGTTTCCCCTCATCTTTCCCTCAGAGCCAGCCCAGGCTTCTGGGCCTTATGTGGAGATCATCGAACAGCCGAA
GCAACGGGGCATGCGATTCCGCTATAAATGCGAGGGGCGCTCAGCGGGCAGTATTCCTGGCGAGAGAAGCACAGATACCA
CCAAGACACAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI23595

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5638430..5638689 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024927 (Rela) NM_009045 v-rel reticuloendotheliosis viral oncogene homolog A (avian) Gene [Source:MGI (curated);Acc:Rela-001]

 
Come back to gene ENSMUSG00000024927


For any suggestions or comments, please send an email to unitrap@crg.es