Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone DB0212
Clone ID DB0212
Vector pGT1lxr
Project sanger

Sequence tag DB0212
Sequence
GCTGGGGACGACCTGCTGGAGCTCATCCAAGGCCTGTTCTTATTTAACCCGTGTACGCGGACCACAGCCTCACAGGCATT
GAAGACCAAGTACTTCAGTAACCGCCCCGGGCCAACACCTGGATGCCAGCTCCCGAGACCAAACTGTCCGGTGGAGGCAT
TAAAGGAACCGGCGAATCCAACCGTGGCAACAAAGCGGCAATGAGCAGAGGCCTTAGAACAAG
Sequence Type mRNA
Unitrap ID UNI470

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101474346..101476396 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069089 (Cdk7) NM_009874 cyclin-dependent kinase 7 (homolog of Xenopus MO15 cdk-activating kinase) Gene [Source:MGI Symbol;Acc:MGI:102956]

 
Come back to gene ENSMUSG00000069089


For any suggestions or comments, please send an email to unitrap@crg.es